Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3191773
End position: 3191796
Length: 24

DNA sequence
>NC_013739, from 3191773 to 3191796 (24 bp); Conexibacter woesei DSM 14684 GCCGCCGCCCCCGCCGCCGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3191141-3195046	Sequence	Cwoe_2987 - fibronectin type III domain-containing protein (Protein is coded in complementary strand; from 3195046 to 3191141)