Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3208998
End position: 3209021
Length: 24

DNA sequence
>NC_013739, from 3208998 to 3209021 (24 bp); Conexibacter woesei DSM 14684 CGCCGTCGCCGGCGCGGTCGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3208499-3209188	Sequence	Cwoe_2999 - alpha/beta hydrolase fold protein (Protein is coded in complementary strand; from 3209188 to 3208499)