Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3247274
End position: 3247300
Length: 27

DNA sequence
>NC_013739, from 3247274 to 3247300 (27 bp); Conexibacter woesei DSM 14684 CCGTCGCGGTCGTCGCGGTCGTCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3246934-3247407	Sequence	Cwoe_3041 - blue (type 1) copper domain-containing protein (Protein is coded in complementary strand; from 3247407 to 3246934)