Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3248926
End position: 3248949
Length: 24

DNA sequence
>NC_013739, from 3248926 to 3248949 (24 bp); Conexibacter woesei DSM 14684 CGGTCTCGGTCTCGGTCTCGGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3248907-3249599	Sequence	Cwoe_3044 - hypothetical protein (Protein is coded in complementary strand; from 3249599 to 3248907)