Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3265611
End position: 3265634
Length: 24

DNA sequence
>NC_013739, from 3265611 to 3265634 (24 bp); Conexibacter woesei DSM 14684 TCCGCCTCCGCCTCCTCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3265201-3267336	Sequence	Cwoe_3062 - hypothetical protein (Protein is coded in complementary strand; from 3267336 to 3265201)