Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 329148
End position: 329192
Length: 45

DNA sequence
>NC_013739, from 329148 to 329192 (45 bp); Conexibacter woesei DSM 14684 CGCCGCGTCGCCGCCCGCGGCGTCGCCGTGCTCCGCGCGGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 328660-329808	Sequence	Cwoe_0319 - PAS/PAC sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 329808 to 328660)