Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3379133
End position: 3379156
Length: 24

DNA sequence
>NC_013739, from 3379133 to 3379156 (24 bp); Conexibacter woesei DSM 14684 GGCGCCGGCGCGCGCGCCGGCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3378634-3379425	Sequence	Cwoe_3172 - methyltransferase type 12 (Protein is coded in complementary strand; from 3379425 to 3378634)