Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3437819
End position: 3437842
Length: 24

DNA sequence
>NC_013739, from 3437819 to 3437842 (24 bp); Conexibacter woesei DSM 14684 CGGCGGCGGTGGCGGCGACCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3435682-3437967	Sequence	Cwoe_3232 - polyribonucleotide nucleotidyltransferase