Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3523535
End position: 3523594
Length: 60

DNA sequence
>NC_013739, from 3523535 to 3523594 (60 bp); Conexibacter woesei DSM 14684 GCGGCGCGGGCGGGAGCGGCGCGGGCGGGAGCGGCGCGGGCGGGAGCGGCGCGGGCGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3522995-3524167	Sequence	Cwoe_3316 - UDP-N-acetylenolpyruvoylglucosamine reductase