Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3534852
End position: 3534875
Length: 24

DNA sequence
>NC_013739, from 3534852 to 3534875 (24 bp); Conexibacter woesei DSM 14684 GCCGTCGCCGTTGACGTCGCCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3532810-3535617	Sequence	Cwoe_3327 - Ig family protein (Protein is coded in complementary strand; from 3535617 to 3532810)