Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3535788
End position: 3535814
Length: 27

DNA sequence
>NC_013739, from 3535788 to 3535814 (27 bp); Conexibacter woesei DSM 14684 CGTCGCCCGCGTCGCCGGCGTCGCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3535706-3536551	Sequence	Cwoe_3328 - ABC transporter (Protein is coded in complementary strand; from 3536551 to 3535706)