Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3551928
End position: 3551963
Length: 36

DNA sequence
>NC_013739, from 3551928 to 3551963 (36 bp); Conexibacter woesei DSM 14684 TCGCGCGCGCCGTCGAGCGCGTCGACGCGCCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3551517-3552845	Sequence	Cwoe_3341 - CdaR family transcriptional regulator (Protein is coded in complementary strand; from 3552845 to 3551517)