Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3565656
End position: 3565700
Length: 45

DNA sequence
>NC_013739, from 3565656 to 3565700 (45 bp); Conexibacter woesei DSM 14684 GCCGCACCCGCCGCCGCACCGCCCGCCGCCGCACCGCCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3564511-3566661	Sequence	Cwoe_3350 - peptidase S9 prolyl oligopeptidase active site domain protein