Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 361785
End position: 361844
Length: 60

DNA sequence
>NC_013739, from 361785 to 361844 (60 bp); Conexibacter woesei DSM 14684 CGTCCGTCGCCGCGCCGTCCGTCGTCGCGCCGTCCGTCGCCGCGCCCTCCGTCGCCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 361760-362827	Sequence	Cwoe_0354 - alpha/beta hydrolase fold protein (Protein is coded in complementary strand; from 362827 to 361760)