Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3619516
End position: 3619539
Length: 24

DNA sequence
>NC_013739, from 3619516 to 3619539 (24 bp); Conexibacter woesei DSM 14684 CGGCGCGGGCGCCCGCGCCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3619497-3620678	Sequence	Cwoe_3397 - alkanesulfonate monooxygenase (Protein is coded in complementary strand; from 3620678 to 3619497)