Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3651279
End position: 3651314
Length: 36

DNA sequence
>NC_013739, from 3651279 to 3651314 (36 bp); Conexibacter woesei DSM 14684 GATCTGCTCGACGATCTGGTCGCCGATCCGCTGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3650590-3651639	Sequence	Cwoe_3422 - oligopeptide/dipeptide ABC transporter ATPase (Protein is coded in complementary strand; from 3651639 to 3650590)