Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3675928
End position: 3675981
Length: 54

DNA sequence
>NC_013739, from 3675928 to 3675981 (54 bp); Conexibacter woesei DSM 14684 CCGGCCGCACCGTCTCTGCCGGCCGCACCGTCTCTGCCGGCCGCACCGTCTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3675502-3677493	Sequence	Cwoe_3449 - collagen (Protein is coded in complementary strand; from 3677493 to 3675502)