Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3742781
End position: 3742804
Length: 24

DNA sequence
>NC_013739, from 3742781 to 3742804 (24 bp); Conexibacter woesei DSM 14684 CGATCACGAGCACGATCGCGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3742381-3742869	Sequence	Cwoe_3519 - lipoprotein signal peptidase (Protein is coded in complementary strand; from 3742869 to 3742381)