Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3746386
End position: 3746439
Length: 54

DNA sequence
>NC_013739, from 3746386 to 3746439 (54 bp); Conexibacter woesei DSM 14684 CCGGCCGCACCCACGCTCCCCGCCGCACCCACGCTGCCCGCCGCCCCCCCGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3746152-3747498	Sequence	Cwoe_3525 - polynucleotide adenylyltransferase (Protein is coded in complementary strand; from 3747498 to 3746152)