Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3747326
End position: 3747355
Length: 30

DNA sequence
>NC_013739, from 3747326 to 3747355 (30 bp); Conexibacter woesei DSM 14684 CGACGTCGCCGTCGACGACGAGGTCGAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3746152-3747498	Sequence	Cwoe_3525 - polynucleotide adenylyltransferase (Protein is coded in complementary strand; from 3747498 to 3746152)