Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 377593
End position: 377616
Length: 24

DNA sequence
>NC_013739, from 377593 to 377616 (24 bp); Conexibacter woesei DSM 14684 CGCTCTCGGTCTGGCTCTCGCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 377582-379567	Sequence	Cwoe_0370 - glycoside hydrolase family protein (Protein is coded in complementary strand; from 379567 to 377582)