Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3789877
End position: 3789912
Length: 36

DNA sequence
>NC_013739, from 3789877 to 3789912 (36 bp); Conexibacter woesei DSM 14684 GCGGCGAGCGCCGCCGCGGGCGCCGCGGCGAGCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3789262-3789963	Sequence	Cwoe_3560 - hypothetical protein (Protein is coded in complementary strand; from 3789963 to 3789262)