Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3797003
End position: 3797062
Length: 60

DNA sequence
>NC_013739, from 3797003 to 3797062 (60 bp); Conexibacter woesei DSM 14684 GTCACGGCATCGCCTCGCCCGGCATCGCCTCGCCCGGCATCGCCTCGCCCGGCATCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3797005-3797853	Sequence	Cwoe_3567 - hypothetical protein (Protein is coded in complementary strand; from 3797853 to 3797005)