Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3817554
End position: 3817577
Length: 24

DNA sequence
>NC_013739, from 3817554 to 3817577 (24 bp); Conexibacter woesei DSM 14684 CGTCGAAGTCGACGTCGCCGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3817442-3818293	Sequence	Cwoe_3588 - methylenetetrahydrofolate dehydrogenase (Protein is coded in complementary strand; from 3818293 to 3817442)