Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3823052
End position: 3823078
Length: 27

DNA sequence
>NC_013739, from 3823052 to 3823078 (27 bp); Conexibacter woesei DSM 14684 GCGGGACGAGCGGGACGTGCGCGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3822496-3823245	Sequence	Cwoe_3592 - serine O-acetyltransferase (Protein is coded in complementary strand; from 3823245 to 3822496)