Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3839866
End position: 3839889
Length: 24

DNA sequence
>NC_013739, from 3839866 to 3839889 (24 bp); Conexibacter woesei DSM 14684 CGTGCGCTTGCGCGAGCGCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3838947-3840137	Sequence	Cwoe_3607 - alpha/beta hydrolase (Protein is coded in complementary strand; from 3840137 to 3838947)