Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3855867
End position: 3855920
Length: 54

DNA sequence
>NC_013739, from 3855867 to 3855920 (54 bp); Conexibacter woesei DSM 14684 CTCGGGCGCAGCAGCTCTCTCGGCCGCAGCAGCTCTCTCTGCCGCAGCAGGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3855562-3856635	Sequence	Cwoe_3622 - translation initiation factor IF-3 (Protein is coded in complementary strand; from 3856635 to 3855562)