Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3905964
End position: 3905987
Length: 24

DNA sequence
>NC_013739, from 3905964 to 3905987 (24 bp); Conexibacter woesei DSM 14684 GCCGGCGCAGGCGCCGGCGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3904882-3906570	Sequence	Cwoe_3669 - dihydroxy-acid dehydratase (Protein is coded in complementary strand; from 3906570 to 3904882)