Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3913282
End position: 3913326
Length: 45

DNA sequence
>NC_013739, from 3913282 to 3913326 (45 bp); Conexibacter woesei DSM 14684 CAGCCGGAGCGGCCTCAGCCGCAGCGTCGTCGGCGGGAGCGCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3913170-3913760	Sequence	Cwoe_3678 - 50S ribosomal protein L19 (Protein is coded in complementary strand; from 3913760 to 3913170)