Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3946834
End position: 3946869
Length: 36

DNA sequence
>NC_013739, from 3946834 to 3946869 (36 bp); Conexibacter woesei DSM 14684 GCGCCGAGCACGACGCCGAGGACGGCGCCGATCAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3946657-3949215	Sequence	Cwoe_3715 - hypothetical protein (Protein is coded in complementary strand; from 3949215 to 3946657)