Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3949927
End position: 3949950
Length: 24

DNA sequence
>NC_013739, from 3949927 to 3949950 (24 bp); Conexibacter woesei DSM 14684 TCGCGGTGGCGGTGGCGGTCACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3949215-3949949	Sequence	Cwoe_3716 - ABC transporter (Protein is coded in complementary strand; from 3949949 to 3949215)