Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3994944
End position: 3994967
Length: 24

DNA sequence
>NC_013739, from 3994944 to 3994967 (24 bp); Conexibacter woesei DSM 14684 GCCCGCGCTCCCGCGCGACCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3993794-3995227	Sequence	Cwoe_3759 - UDP-N-acetylmuramate--L-alanine ligase (Protein is coded in complementary strand; from 3995227 to 3993794)