Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4024092
End position: 4024115
Length: 24

DNA sequence
>NC_013739, from 4024092 to 4024115 (24 bp); Conexibacter woesei DSM 14684 CGACCGGGACCGCGGCCGCGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4023734-4024426	Sequence	Cwoe_3787 - hypothetical protein (Protein is coded in complementary strand; from 4024426 to 4023734)