Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4025488
End position: 4025514
Length: 27

DNA sequence
>NC_013739, from 4025488 to 4025514 (27 bp); Conexibacter woesei DSM 14684 CCGCCGCCACCACCGCCACCGCCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4024725-4025516	Sequence	Cwoe_3788 - histidine kinase (Protein is coded in complementary strand; from 4025516 to 4024725)
ORF... 4025513-4026250	Sequence	Cwoe_3789 - two component transcriptional regulator (Protein is coded in complementary strand; from 4026250 to 4025513)