Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4033321
End position: 4033344
Length: 24

DNA sequence
>NC_013739, from 4033321 to 4033344 (24 bp); Conexibacter woesei DSM 14684 CGGTGACGGTCACCGTGACGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4033215-4035194	Sequence	Cwoe_3797 - hypothetical protein (Protein is coded in complementary strand; from 4035194 to 4033215)