Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4065645
End position: 4065668
Length: 24

DNA sequence
>NC_013739, from 4065645 to 4065668 (24 bp); Conexibacter woesei DSM 14684 CGACGGCGACGTCGTCGGCGACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4064936-4065928	Sequence	Cwoe_3828 - alpha/beta hydrolase fold protein (Protein is coded in complementary strand; from 4065928 to 4064936)