Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 40824
End position: 40847
Length: 24

DNA sequence
>NC_013739, from 40824 to 40847 (24 bp); Conexibacter woesei DSM 14684 GTCGCGGGCGCGCTCGCGGTCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 40513-41130	Sequence	Cwoe_0040 - flagellar assembly protein FliH/type III secretion system HrpE