Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4117609
End position: 4117632
Length: 24

DNA sequence
>NC_013739, from 4117609 to 4117632 (24 bp); Conexibacter woesei DSM 14684 CCGGCGCCGCCGTCGGCGCCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4117144-4118670	Sequence	Cwoe_3880 - amidase (Protein is coded in complementary strand; from 4118670 to 4117144)