Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4164773
End position: 4164796
Length: 24

DNA sequence
>NC_013739, from 4164773 to 4164796 (24 bp); Conexibacter woesei DSM 14684 GCCGCCGCCGTCGCCGGCGACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4163601-4164872	Sequence	Cwoe_3922 - peptidase S1 and S6 chymotrypsin/Hap (Protein is coded in complementary strand; from 4164872 to 4163601)