Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4170575
End position: 4170598
Length: 24

DNA sequence
>NC_013739, from 4170575 to 4170598 (24 bp); Conexibacter woesei DSM 14684 GCGCGCGCTCGCACGCGCGCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4169615-4170589	Sequence	Cwoe_3929 - hypothetical protein (Protein is coded in complementary strand; from 4170589 to 4169615)