Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4173852
End position: 4173875
Length: 24

DNA sequence
>NC_013739, from 4173852 to 4173875 (24 bp); Conexibacter woesei DSM 14684 CCGCGAACGCGACGGCGACCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4173326-4174309	Sequence	Cwoe_3933 - pyruvate dehydrogenase (acetyl-transferring) (Protein is coded in complementary strand; from 4174309 to 4173326)