Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4194814
End position: 4194837
Length: 24

DNA sequence
>NC_013739, from 4194814 to 4194837 (24 bp); Conexibacter woesei DSM 14684 CCGCCGCCGCCTCCGCGGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4193337-4195079	Sequence	Cwoe_3952 - aldehyde dehydrogenase (Protein is coded in complementary strand; from 4195079 to 4193337)