Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4261483
End position: 4261506
Length: 24

DNA sequence
>NC_013739, from 4261483 to 4261506 (24 bp); Conexibacter woesei DSM 14684 CGACGGCGTCGGCGACCGCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4260966-4261700	Sequence	Cwoe_4011 - short-chain dehydrogenase/reductase SDR (Protein is coded in complementary strand; from 4261700 to 4260966)