Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4325745
End position: 4325780
Length: 36

DNA sequence
>NC_013739, from 4325745 to 4325780 (36 bp); Conexibacter woesei DSM 14684 CCGCCGAGGAACTCGCCGAGGATCTCGCCGATGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4325574-4326419	Sequence	Cwoe_4074 - binding-protein-dependent transporters inner membrane component (Protein is coded in complementary strand; from 4326419 to 4325574)