Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4343424
End position: 4343450
Length: 27

DNA sequence
>NC_013739, from 4343424 to 4343450 (27 bp); Conexibacter woesei DSM 14684 CGCGGCGAGCGCAGCGAGCGCGTCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4341766-4343979	Sequence	Cwoe_4090 - 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase (Protein is coded in complementary strand; from 4343979 to 4341766)