Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 434834
End position: 434857
Length: 24

DNA sequence
>NC_013739, from 434834 to 434857 (24 bp); Conexibacter woesei DSM 14684 GAGCCGGTGAGTCGGTGAGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 434664-434852	Sequence	Cwoe_0423 - hypothetical protein
ORF... 434857-436002	Sequence	Cwoe_0424 - 8-amino-7-oxononanoate synthase