Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4363914
End position: 4363938
Length: 25

DNA sequence
>NC_013739, from 4363914 to 4363938 (25 bp); Conexibacter woesei DSM 14684 CCGCGCCGAGCCGCCTCGCGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4363317-4364522	Sequence	Cwoe_4107 - VWA containing CoxE family protein (Protein is coded in complementary strand; from 4364522 to 4363317)