Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4395430
End position: 4395456
Length: 27

DNA sequence
>NC_013739, from 4395430 to 4395456 (27 bp); Conexibacter woesei DSM 14684 CGTCGCCGACGTCGACGACCTCGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4394613-4395644	Sequence	Cwoe_4130 - alcohol dehydrogenase GroES domain protein (Protein is coded in complementary strand; from 4395644 to 4394613)