Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4443222
End position: 4443257
Length: 36

DNA sequence
>NC_013739, from 4443222 to 4443257 (36 bp); Conexibacter woesei DSM 14684 CCACCGCCGCCTCCTCCGCCGCTTCCACCTCCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4442805-4443809	Sequence	Cwoe_4181 - blue (type 1) copper domain-containing protein (Protein is coded in complementary strand; from 4443809 to 4442805)