Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4446041
End position: 4446064
Length: 24

DNA sequence
>NC_013739, from 4446041 to 4446064 (24 bp); Conexibacter woesei DSM 14684 CGACGACGTCGACGACGTCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4445626-4447200	Sequence	Cwoe_4184 - adenylate/guanylate cyclase with integral membrane sensor (Protein is coded in complementary strand; from 4447200 to 4445626)